WormBase Tree Display for Variation: WBVar00000325

WBVar00000325 Evidence: Paper_evidence: WBPaper00028766
  Name: Public_name: ay9
    Other_name: F31E3.1.1:c.234G>A
      CE01241:p.Met78Ile
    HGVSg: CHROMOSOME_III:g.6980311G>A
  Sequence_details: SMap: S_parent: Sequence: F31E3
    Flanking_sequences: agatcctcaattaatgcgacttgataatat ttagtggcggaaggcgttgcaggaccagat
    Mapping_target: F31E3
    Type_of_mutation: Substitution: g h Paper_evidence: WBPaper00028766
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00028765
    Laboratory: NH
    Status: Live
  Affects: Gene: WBGene00000443
    Transcript: F31E3.1.1 (12)
    Interactor: WBInteraction000051965
      WBInteraction000502692
      WBInteraction000504023
      WBInteraction000520179
  Genetics: Interpolated_map_position: III -0.853262
    Mapping_data: In_multi_point: 3169
        3170
  Description: Phenotype: WBPhenotype:0000006 Paper_evidence: WBPaper00028766
        Curator_confirmed: WBPerson557
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00028766
            Curator_confirmed: WBPerson557
      WBPhenotype:0000165 Paper_evidence: WBPaper00028766
        Curator_confirmed: WBPerson557
        Remark: Expression of ajm-1p::gfp in a ceh-20(ay9) In L1 larva only P5.p and P6.p remained unfused, the other VPCs fused with the hypodermis. In wildtype all VPC remained unfused. Paper_evidence: WBPaper00028766
            Curator_confirmed: WBPerson557
        Phenotype_assay: Genotype: ajm-1::gfp Paper_evidence: WBPaper00028766
              Curator_confirmed: WBPerson557
      WBPhenotype:0000220 Paper_evidence: WBPaper00028766
        Curator_confirmed: WBPerson557
        Remark: Failure to execute secondary vulval cell fate. In the ceh-20(ay9) animal, both the anterior and posterior secondary vulval cells are missing: P5.p and P7.p remained non-induced, adopting tertiary fates. Paper_evidence: WBPaper00028766
            Curator_confirmed: WBPerson557
      WBPhenotype:0000245 Paper_evidence: WBPaper00028766
        Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
          WBPerson557
        Remark: Egl, SM migration defects. Stronger alleles are larval lethal, Unc,defective in Q daughter migrations, M lineage. Males do not mate, have defective tails Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00028766
            Curator_confirmed: WBPerson557
      WBPhenotype:0000624 Paper_evidence: WBPaper00028766
        Curator_confirmed: WBPerson557
        Remark: The lack of utse (uterine seam) syncytium formation was evident in 73 percent of ceh-20(ay9) animals. Paper_evidence: WBPaper00028766
            Curator_confirmed: WBPerson557
      WBPhenotype:0000640 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: Egl, SM migration defects. Stronger alleles are larval lethal, Unc,defective in Q daughter migrations, M lineage. Males do not mate, have defective tails Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000698 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: Vul, Egl, SM migration defects. Stronger alleles are larval lethal, Unc,defective in Q daughter migrations, M lineage. Males do not mate, have defective tails Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001278 Paper_evidence: WBPaper00028766
        Curator_confirmed: WBPerson557
        Remark: ceh-20(ay9) mutations significantly diminished the expression of lag-2::gfp in the VPCs prior to vulval induction. In wildtype worms, lag-2::gfp was continuously expressed in all VPCs prior to vulval induction, but its expression became restricted to P6.p at the time of vulval induction. Paper_evidence: WBPaper00028766
            Curator_confirmed: WBPerson557
        Phenotype_assay: Genotype: lag-2::gfp Paper_evidence: WBPaper00028766
              Curator_confirmed: WBPerson557
      WBPhenotype:0001414 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: Males do not mate, have defective tails Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001586 Paper_evidence: WBPaper00028766
        Curator_confirmed: WBPerson557
        Remark: We found that 14 percent of ceh-20 (ay9) larvae have two gonadal cells that expressed the AC marker LIN-3::GFP reporter versus the normal single cell found in wild-type animals. Dual AC phenotype. Paper_evidence: WBPaper00028766
            Curator_confirmed: WBPerson557
        Phenotype_assay: Genotype: lin-3::gfp Paper_evidence: WBPaper00028766
              Curator_confirmed: WBPerson557
  Reference: WBPaper00028766
  Method: Substitution_allele