WormBase Tree Display for Variation: WBVar00000307
expand all nodes | collapse all nodes | view schema
| WBVar00000307 | Evidence | Paper_evidence | WBPaper00005096 | ||
|---|---|---|---|---|---|
| Name | Public_name | ax77 | |||
| HGVSg | |||||
| Sequence_details | SMap | S_parent | Sequence | F10C5 | |
| Flanking_sequences | acgggactcccgatgattatcacaaaaatc | gcgtgctcaaacgcccgtcacgatcat | |||
| Mapping_target | F10C5 | ||||
| Type_of_mutation | Substitution | gcc | ctn | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | JH | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00003134 | |||
| Transcript | F10C5.1.1 | VEP_consequence | coding_sequence_variant | ||
| VEP_impact | MODIFIER | ||||
| cDNA_position | 1024-1026 | ||||
| CDS_position | 1015-1017 | ||||
| Protein_position | 339 | ||||
| Exon_number | 6/10 | ||||
| Codon_change | GCC/CTN | ||||
| Genetics | Interpolated_map_position | III | -26.8405 | ||
| Description | Phenotype | WBPhenotype:0001216 | Paper_evidence | WBPaper00004484 | |
| Curator_confirmed | WBPerson205 | ||||
| Reference | WBPaper00004484 | ||||
| WBPaper00005096 | |||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003134 Missense 339 A to L | Paper_evidence | WBPaper00005096 | ||
| Method | Substitution_allele |
