WormBase Tree Display for Variation: WBVar00000255
expand all nodes | collapse all nodes | view schema
| WBVar00000255 | Evidence | Paper_evidence | WBPaper00004718 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ar481 | |||||
| Other_name (21) | |||||||
| HGVSg | CHROMOSOME_V:g.6216795G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | W06H8 | |||
| Flanking_sequences | cacctaattttttttaattttcagggagaa | gattcgacaagggagccgacgaagccgaat | |||||
| Mapping_target | W06H8 | ||||||
| Type_of_mutation | Substitution | g | m | Paper_evidence | WBPaper00004718 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | GS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004373 | |||||
| Transcript (12) | |||||||
| Genetics | Interpolated_map_position | V | -0.206312 | ||||
| Reference | WBPaper00004718 | ||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00004373 Missense 459 G to R | Paper_evidence | WBPaper00004718 | ||||
| Method | Substitution_allele |
