WormBase Tree Display for Variation: WBVar00000239
expand all nodes | collapse all nodes | view schema
WBVar00000239 | Name | Public_name | ar221 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE23547:p.Pro127Leu | ||||||
C15F1.3b.1:c.380C>T | |||||||
CE23546:p.Pro127Leu | |||||||
C15F1.3a.1:c.380C>T | |||||||
HGVSg | CHROMOSOME_II:g.6965070G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | C15F1 | |||
Flanking_sequences | AATCCTCTTCATCCGATCAAAACGAATATC | ACATTATATCCAGgttttcttgacttttag | |||||
Mapping_target | C15F1 | ||||||
Type_of_mutation | Substitution | C | T | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004640 | ||||||
WBStrain00006449 | |||||||
Laboratory | GS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006605 | |||||
Transcript (2) | |||||||
Genetics | Interpolated_map_position | II | 0.171015 | ||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00053589 | |||
Curator_confirmed | WBPerson15784 | ||||||
WBPhenotype:0000822 | Paper_evidence | WBPaper00053589 | |||||
Curator_confirmed | WBPerson15784 | ||||||
WBPhenotype:0001025 | Paper_evidence | WBPaper00053589 | |||||
Curator_confirmed | WBPerson15784 | ||||||
WBPhenotype:0001572 | Paper_evidence | WBPaper00053589 | |||||
Curator_confirmed | WBPerson15784 | ||||||
Remark | Figure 3, hermaphrodite sex phenotype at 15 degrees Celsius; intersex phenotype at 20 degree Celsius; male sex phenotype at 25 degree Celsius | Paper_evidence | WBPaper00053589 | ||||
Curator_confirmed | WBPerson15784 | ||||||
Phenotype_not_observed | WBPhenotype:0001236 | Paper_evidence | WBPaper00036019 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals did not differ significantly in the levels of expression of speramtheca and sheath reporter transgenes, fkh-6::GFP and lim-7::GFP. | Paper_evidence | WBPaper00036019 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00036019 | ||||||
WBPaper00015605 | |||||||
WBPaper00053589 | |||||||
Method | Substitution_allele |