WormBase Tree Display for Variation: WBVar00000225

WBVar00000225 Evidence: Paper_evidence: WBPaper00004474
  Name: Public_name: ar179
    Other_name: CE08317:p.Ser57_Ter218delextTer?
      C18E3.8.1:c.169_654del
    HGVSg: CHROMOSOME_I:g.4209405_4210122del
  Sequence_details: SMap: S_parent: Sequence: C18E3
    Flanking_sequences: ggactgttccattcatacgataccgcggat gtgaatgaagtggattcccctgacacaaca
    Mapping_target: C18E3
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00008037
    Laboratory: GS
    Status: Live
  Affects: Gene: WBGene00001985
    Transcript: C18E3.8.1 (11)
  Genetics: Interpolated_map_position: I -1.59477
    Mapping_data: In_multi_point: 4412
  Reference: WBPaper00004474
  Remark: ar179 has break points within codon Ser-57 and codon Tyr-218. The exact position of these breakpoints is not detailed; the left flanking sequence flanks codon Ser-57 while the right flanking sequence flanks codon Tyr-218. Paper_evidence: WBPaper00004474
  Method: Deletion_allele