WormBase Tree Display for Variation: WBVar00000220
expand all nodes | collapse all nodes | view schema
| WBVar00000220 | Evidence | Paper_evidence | WBPaper00003577 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ar173 | |||||
| Other_name | CE14448:p.Trp174Ter | ||||||
| W02D7.7.1:c.521delinsA | |||||||
| HGVSg | CHROMOSOME_V:g.8301731delinsT | ||||||
| Sequence_details | SMap | S_parent | Sequence | W02D7 | |||
| Flanking_sequences | atgaaaacacgaactctcgcgtcgttatgt | gccgctttcgaggctttcgtattggttgga | |||||
| Mapping_target | W02D7 | ||||||
| Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00003577 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | GS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004766 | |||||
| Transcript | W02D7.7.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | W02D7.7.1:c.521delinsA | ||||||
| HGVSp | CE14448:p.Trp174Ter | ||||||
| cDNA_position | 536-537 | ||||||
| CDS_position | 521-522 | ||||||
| Protein_position | 174 | ||||||
| Exon_number | 5/6 | ||||||
| Codon_change | tGG/tAG | ||||||
| Amino_acid_change | W/* | ||||||
| Genetics | Interpolated_map_position | V | 1.27295 | ||||
| Reference | WBPaper00003577 | ||||||
| Remark | ar173 is either a W(174) to amber or W(174) to opal mutation | Paper_evidence | WBPaper00003577 | ||||
| Method | Substitution_allele |
