WormBase Tree Display for Variation: WBVar00000109
expand all nodes | collapse all nodes | view schema
WBVar00000109 | Evidence | Paper_evidence | WBPaper00004836 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ak4 | |||||||
Other_name | CE30128:p.Glu352_Ter750delextTer? | ||||||||
F07F6.6.1:c.1054_2250del | |||||||||
HGVSg | CHROMOSOME_II:g.5443296_5445175del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F07F6 | |||||
Flanking_sequences | tttaatgataaatgtgaacgaattggagtc | atatgggattcaactcgactggaatttgaa | |||||||
Mapping_target | F07F6 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (13) | |||||||||
Laboratory | VM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003774 | |||||||
Transcript | F07F6.6.1 (11) | ||||||||
Interactor | WBInteraction000501705 | ||||||||
Genetics | Interpolated_map_position | II | -1.51326 | ||||||
Mapping_data | In_multi_point | 4538 | |||||||
Description | Phenotype (11) | ||||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All these animals retained a similar number of eggs when compared to wild-type animals (~10 eggs). | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay (2) | |||||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00032082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not exhibit reduced pharyngeal pumping when compared with daf-7(e1375). | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay (2) | |||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00031974 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000147 | Paper_evidence | WBPaper00031974 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Starved animals showed an enhanced slowing in response to food (data not shown). | Paper_evidence | WBPaper00031974 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00031974 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed no gross locomotion defect (data not shown). | Paper_evidence | WBPaper00031974 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001072 | Paper_evidence | WBPaper00031974 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals moved more slowly in response to food (data not shown). | Paper_evidence | WBPaper00031974 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00031974 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed normal chemotaxis to NaCl in mock-conditioned assays and avoided NaCl just after conditioning. | Paper_evidence | WBPaper00031974 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001462 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not show defects in chemotaxis to NaCl compared to wild type. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants defective in the synthesis and reception of nonessential excitatory neurotransmitters respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited enhanced-gustatory plasticity, i.e. strong avoidance to NaCl after starvation, similar to that observed for wild type. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002370 | Paper_evidence | WBPaper00059155 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Quote from paper: "The results illustrated in Figure 3 suggest that mutants associated with glutamate receptor glr-1, glr-2, nmr-1, nmr-2 thermal avoidance was not affected." | Paper_evidence | WBPaper00059155 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay (2) | |||||||||
Disease_info | Models_disease | DOID:1289 | |||||||
Models_disease_in_annotation | WBDOannot00000907 | ||||||||
WBDOannot00000908 | |||||||||
Reference (16) | |||||||||
Method | Deletion_allele |