WormBase Tree Display for Variation: WBVar00000089
expand all nodes | collapse all nodes | view schema
WBVar00000089 | Name | Public_name | ad1116 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y48B6A.4.1:c.806-1G>A | |||||||
HGVSg | CHROMOSOME_II:g.14169168C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y48B6A | ||||
Flanking_sequences | atgagaagtaaattgaaaattcacaattca | aaatcacaaacttcctatccgtgatggtatt | ||||||
Mapping_target | Y48B6A | |||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson32 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (5) | ||||||||
Affects | Gene | WBGene00001133 | ||||||
Transcript | Y48B6A.4.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y48B6A.4.1:c.806-1G>A | |||||||
Intron_number | 4/7 | |||||||
Interactor (34) | ||||||||
Genetics | Interpolated_map_position | II | 22.4739 | |||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0001068 | Paper_evidence | WBPaper00031241 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Pre-exposure to mianserin blocked serotonin-induced egg laying as it does in N2. | Paper_evidence | WBPaper00031241 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Pre-exposure to 50uM mianserin. | Paper_evidence | WBPaper00031241 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002087 | Paper_evidence | WBPaper00031326 | ||||||
Curator_confirmed | WBPerson2857 | |||||||
Remark | growth in hydrogen sulfide enhances thermotolerance relative to untreated animals | Paper_evidence | WBPaper00031326 | |||||
Curator_confirmed | WBPerson2857 | |||||||
Reference (19) | ||||||||
Remark | This sequence alteration has not been confirmed. | Person_evidence | WBPerson32 | |||||
Method | Substitution_allele |