WormBase Tree Display for Variation: WBVar00000083
expand all nodes | collapse all nodes | view schema
WBVar00000083 | Evidence | Paper_evidence | WBPaper00002920 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ad1051 | |||||||
Other_name | CE25076:p.Trp312Ter | ||||||||
CE13573:p.Trp133Ter | |||||||||
R11G10.1b.1:c.399G>A | |||||||||
R11G10.1a.1:c.936G>A | |||||||||
HGVSg | CHROMOSOME_V:g.13501125C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T10G3 | |||||
Flanking_sequences | tagtgtacaactgacattccgtgagagttg | gtcgataagagactcagcttcggagtgaaa | |||||||
Mapping_target | T10G3 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002920 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (12) | |||||||||
Laboratory | DA | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | V | 5.36893 | ||||||
Description | Phenotype | WBPhenotype:0000547 | Paper_evidence | WBPaper00002920 | |||||
Curator_confirmed | WBPerson134 | ||||||||
Remark | enhanced by difficult to eat E. coli strains | Paper_evidence | WBPaper00002920 | ||||||
Curator_confirmed | WBPerson134 | ||||||||
WBPhenotype:0000658 | Paper_evidence | WBPaper00002920 | |||||||
Curator_confirmed | WBPerson134 | ||||||||
Remark | lacks glutamatergic M3 neurotransmission | Paper_evidence | WBPaper00002920 | ||||||
Curator_confirmed | WBPerson134 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003754 | PATO:0000460 | Paper_evidence | WBPaper00002920 | ||||
Curator_confirmed | WBPerson134 | ||||||||
GO_term | GO:0061535 | PATO:0000460 | Paper_evidence | WBPaper00002920 | |||||
Curator_confirmed | WBPerson134 | ||||||||
Molecule_affected | WBMol:00005503 | PATO:0000460 | Paper_evidence | WBPaper00002920 | |||||
Curator_confirmed | WBPerson134 | ||||||||
WBPhenotype:0001444 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited defective gustatory plasticity of NaCl. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl after various pre-treatments: a 15-min wash in CTX buffer with or without 100 mM NaCl (liquid), or 30 min on a CTX plate with or without 100 mM NaCl, and in the presence or absence of bacteria, 500 mM glycerol, or 3 uL of benzaldehyde. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001453 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed reduced avoidance of 1 M NaCl. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001462 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed wild-type, or even stronger, chemotaxis to NaCl. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited significant reduced starvation-enhanced gustatory plasticity compared to wild type. | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00003954 | |||||||
Curator_confirmed | WBPerson134 | ||||||||
Remark | Synthetic resistance with avr-14(ad1302) | Paper_evidence | WBPaper00003954 | ||||||
Curator_confirmed | WBPerson134 | ||||||||
Synthetic resistance with avr-14(ad1305) | Paper_evidence | WBPaper00003954 | |||||||
Curator_confirmed | WBPerson134 | ||||||||
synthetic resistance with glc-1(pk54) | Paper_evidence | WBPaper00003954 | |||||||
Curator_confirmed | WBPerson134 | ||||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00003954 | |||||
Curator_confirmed | WBPerson134 | ||||||||
Phenotype_assay | Genotype | avr-14(ad1302) | Paper_evidence | WBPaper00003954 | |||||
Curator_confirmed | WBPerson134 | ||||||||
avr-14(ad1305) | Paper_evidence | WBPaper00003954 | |||||||
Curator_confirmed | WBPerson134 | ||||||||
glc-1(pk54) | Paper_evidence | WBPaper00003954 | |||||||
Curator_confirmed | WBPerson134 | ||||||||
WBPhenotype:0002399 | Paper_evidence | WBPaper00003954 | |||||||
Curator_confirmed | WBPerson134 | ||||||||
Remark | Loss of M3 neurotransmission | Paper_evidence | WBPaper00003954 | ||||||
Curator_confirmed | WBPerson134 | ||||||||
Phenotype_not_observed | WBPhenotype:0001182 | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | avr-15(ad1051) mutants had wild-type fat content | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Fat content was visualized by Nile red staining | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001811 | Paper_evidence | WBPaper00031915 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (11) | |||||||||
Remark | The correct genotype of the DA1316 strain is avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-14(ad1302) I; avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC. | ||||||||
The correct genotype of the DA1370 strain is avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC. | |||||||||
Method | Substitution_allele |