WormBase Tree Display for Variation: WBVar00000075
expand all nodes | collapse all nodes | view schema
WBVar00000075 | Evidence | Paper_evidence | WBPaper00031996 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ad997 | |||||||
Other_name | CE07721:p.Ser761Phe | ||||||||
B0365.3.2:c.2282C>T | |||||||||
B0365.3.1:c.2282C>T | |||||||||
HGVSg | CHROMOSOME_V:g.13127464G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0365 | |||||
Flanking_sequences | acacactcacctcaaatattccagaaatct | tccattcttgacctacatcctgttcggaat | |||||||
Mapping_target | B0365 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031996 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005529 | ||||||||
Laboratory | DA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001137 | |||||||
Transcript | B0365.3.2 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | B0365.3.2:c.2282C>T | ||||||||
HGVSp | CE07721:p.Ser761Phe | ||||||||
cDNA_position | 2290 | ||||||||
CDS_position | 2282 | ||||||||
Protein_position | 761 | ||||||||
Exon_number | 4/8 | ||||||||
Codon_change | tCt/tTt | ||||||||
Amino_acid_change | S/F | ||||||||
B0365.3.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | B0365.3.1:c.2282C>T | ||||||||
HGVSp | CE07721:p.Ser761Phe | ||||||||
cDNA_position | 2290 | ||||||||
CDS_position | 2282 | ||||||||
Protein_position | 761 | ||||||||
Exon_number | 4/7 | ||||||||
Codon_change | tCt/tTt | ||||||||
Amino_acid_change | S/F | ||||||||
Genetics | Interpolated_map_position | V | 4.93579 | ||||||
Description | Phenotype | WBPhenotype:0000019 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were measured for number of pharyngeal pumps in 30 sec (n=12). | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001203 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals appeared to be weakly resistant to the Ach agonist nicotine, | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001980 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 25 young-adult animals were placed on an agar plate containing 10 mM nicotine. Paralysis was examined by probing the animals with a thin glass picker every 10 min. The animals were defined as 'paralyzed' if they showed no body-bending across the midline (see Doi and Iwasaki, 2002). | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed strong intracellular accumulation of UNC-29::GFP fusion protein with slight accumulation of the at the NMJ, similar to the pattern observed in wild-type animals. Large aggregates of the ACR-16::GFP fusion protein were observed in muscle cells. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Is[Pmyo-3::UNC-29::GFP] | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000655 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals responded like wild type to GABA agonist muscimol (data not shown) | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003906 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were treated with muscimol. | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000656 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No abnormalities in cholinergic transmission or nAchR localization were observed. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000680 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In contrast, the response of the eat-6(ad997) mutants was similar to that of the wild-type animals. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 25 young-adult animals were placed on an agar plate containing 1 mM aldicarb. Paralysis was examined by probing the animals with a thin glass picker every 10 min. The animals were defined as 'paralyzed' if they showed no body-bending across the midline (see Doi and Iwasaki, 2002). | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Response to the Ach agonist, levamisole was not any different from that observed for wild-type animals. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 25 young-adult animals were placed on an agar plate containing 100 M levamisole. Paralysis was examined by probing the animals with a thin glass picker every 10 min. The animals were defined as 'paralyzed' if they showed no body-bending across the midline (see Doi and Iwasaki, 2002). | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001321 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No gross differences were observed in the pan-neuronal or GABAergic pattern or expression levels of synaptic vesicle protein SNB-1::GFP compared to wild type. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005829 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs1 (Psnb-1::SNB-1::GFP) or juIs1 (Punc-25::SNB-1::GFP) | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001409 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Large aggregates of the ACR-16::GFP fusion protein were observed in muscle cells. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | pMD906 (Pmyo-3::ACR-16::GFP) | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001685 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Expression of membrane inserted LEV-1 receptors was similar to that observed in wild-type animals. GABA receptor localization and expression was not affected. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For assaying LEV-1 protein localization, animals were injected with fluorescently-labeled anti-HA antibodies into the body cavity (Gottschalk et al., 2005; Gottschalk and Schafer, 2006) and were observed 6 hours later. | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Is[Pmyo-3::UNC-29::GFP] or LEV::3xHA or oxIs22(Punc-49::UNC-49B::GFP) | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031996 | ||||||||
Method | Substitution_allele |