WormBase Tree Display for Variation: WBVar00000046
expand all nodes | collapse all nodes | view schema
WBVar00000046 | Evidence | Author_evidence | De Bono M | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ad609 | ||||||
Other_name | CE06941:p.Thr83Ile | |||||||
C39E6.6.1:c.248C>T | ||||||||
HGVSg | CHROMOSOME_X:g.4769291G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C39E6 | ||||
Flanking_sequences | gaacctggcggcgagcgattgcatgatgtgcatattatcgcttccaatca | tccaatcacaaatgtgtacaaaaactggtactttggaaatcta | ||||||
Mapping_target | C39E6 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000303 | |||||||
WBStrain00000307 | ||||||||
WBStrain00005493 | ||||||||
Laboratory | DA | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003807 | ||||||
Transcript | C39E6.6.1 (12) | |||||||
Interactor (17) | ||||||||
Genetics | Interpolated_map_position | X | -6.64744 | |||||
Description | Phenotype (35) | |||||||
Phenotype_not_observed | WBPhenotype:0000001 | Paper_evidence | WBPaper00056622 | |||||
Curator_confirmed | WBPerson24060 | |||||||
Remark | Figure 3, figure supplement 2: body posture described by eigenworms unaffected. | Paper_evidence | WBPaper00056622 | |||||
Curator_confirmed | WBPerson24060 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00056622 | ||||
Curator_confirmed | WBPerson24060 | |||||||
Genotype | N2 | Paper_evidence | WBPaper00056622 | |||||
Curator_confirmed | WBPerson24060 | |||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00032196 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals grown on heat-killed E. coli exhibited the same life span as wild-type animals. | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Strain | WBStrain00005493 | Paper_evidence | WBPaper00032196 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals did not appear to have any defects in dauer formation. | Paper_evidence | WBPaper00003187 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were assayed on a bacterial lawn. | Paper_evidence | WBPaper00003187 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001006 | Paper_evidence | WBPaper00032196 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Pumping rates were similar to wild type. | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Strain | WBStrain00005493 | Paper_evidence | WBPaper00032196 | ||||
Curator_confirmed | WBPerson712 | |||||||
Treatment | Pumping rates were determined for one day old adult hermaphrodites grown on E. coli or P. aeruginosa. | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001285 | Paper_evidence | WBPaper00045598 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Exposing npr-1(ad609) animals to 10% CO2 resulted in a response similar to that of wild-type animals. | Paper_evidence | WBPaper00045598 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003023 | Paper_evidence | WBPaper00045598 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001764 | Paper_evidence | WBPaper00037908 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | The carbon dioxide-evoked calcium transients of BAG neurons were similar to control. | Paper_evidence | WBPaper00037908 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0002405 | Paper_evidence | WBPaper00056622 | ||||||
Curator_confirmed | WBPerson24060 | |||||||
Remark | Figure 3, figure supplement 1: aggregation phenotype unaffected after removing pheromones using daf-22. | Paper_evidence | WBPaper00056622 | |||||
Curator_confirmed | WBPerson24060 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00056622 | ||||
Curator_confirmed | WBPerson24060 | |||||||
Genotype | N2 | Paper_evidence | WBPaper00056622 | |||||
Curator_confirmed | WBPerson24060 | |||||||
WBPhenotype:0002534 | Paper_evidence | WBPaper00032501 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Examination of five transcriptional targets of the pmk-1 p38 MAPK immune signaling pathway reveals no differences between the WT and npr-1 mutant strains | Paper_evidence | WBPaper00032501 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032501 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Quantitative RT-PCR | Paper_evidence | WBPaper00032501 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (22) | ||||||||
Remark | In addition to the curated mutation ad609 also carries a T(144)->A mutation with flanking sequences of acaccactatcccaaagaggagcatttctt & ctactgttctattgtggatcctctcttttg | Curator_confirmed | WBPerson2970 | |||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003807 Missense 83 T to A | ||||||||
Method | Substitution_allele |