WormBase Tree Display for Variation: WBVar00000015
expand all nodes | collapse all nodes | view schema
WBVar00000015 | Evidence | Paper_evidence | WBPaper00031996 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ad467 | |||||||
Other_name | B0365.3.2:c.1075C>T | ||||||||
CE07721:p.Leu359Phe | |||||||||
B0365.3.1:c.1075C>T | |||||||||
HGVSg | CHROMOSOME_V:g.13128723G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0365 | |||||
Flanking_sequences | tctaccatttgctctgataagacaggaact | tcacccaaaacagaatgactgtcgctcaca | |||||||
Mapping_target | B0365 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031996 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005464 | ||||||||
WBStrain00005507 | |||||||||
WBStrain00054586 | |||||||||
Laboratory | DA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001137 | |||||||
Transcript | B0365.3.2 (12) | ||||||||
B0365.3.1 (12) | |||||||||
Interactor | WBInteraction000503690 | ||||||||
WBInteraction000503691 | |||||||||
WBInteraction000518921 | |||||||||
WBInteraction000541752 | |||||||||
WBInteraction000541753 | |||||||||
Genetics (2) | |||||||||
Description | Phenotype (16) | ||||||||
Phenotype_not_observed | WBPhenotype:0000655 | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals responded like wild type to GABA agonist muscimol (data not shown) | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003906 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were treated with muscimol. | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00003150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant animals did not exhibit a difference in Na, K-ATPase mRNA levels or size. | Paper_evidence | WBPaper00003150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001321 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No gross differences were observed in the pan-neuronal or GABAergic pattern or expression levels of synaptic vesicle protein SNB-1::GFP compared to wild type. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005829 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs1 (Psnb-1::SNB-1::GFP) or juIs1 (Punc-25::SNB-1::GFP) | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001599 | Paper_evidence | WBPaper00003150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Isolated Na, K -ATPase from the mutant showed similar kinetics and sensitivity to Oubain as enzyme isolated from WT worms. | Paper_evidence | WBPaper00003150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001685 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Expression of membrane inserted LEV-1 receptors was not significantly different to that observed in wild-type animals. GABA receptor localization and expression was not affected. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For assaying LEV-1 protein localization, animals were injected with fluorescently-labeled anti-HA antibodies into the body cavity (Gottschalk et al., 2005; Gottschalk and Schafer, 2006) and were observed 6 hours later. | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Is[Pmyo-3::UNC-29::GFP] or LEV::3xHA or oxIs22(Punc-49::UNC-49B::GFP) | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00014520 | ||||||||
WBPaper00015075 | |||||||||
WBPaper00027611 | |||||||||
WBPaper00031996 | |||||||||
WBPaper00001709 | |||||||||
WBPaper00003150 | |||||||||
WBPaper00050508 | |||||||||
WBPaper00059550 | |||||||||
Method | Substitution_allele |