WormBase Tree Display for Variation: WBVar00000015
expand all nodes | collapse all nodes | view schema
WBVar00000015 | Evidence | Paper_evidence | WBPaper00031996 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ad467 | |||||||
Other_name | B0365.3.2:c.1075C>T | ||||||||
CE07721:p.Leu359Phe | |||||||||
B0365.3.1:c.1075C>T | |||||||||
HGVSg | CHROMOSOME_V:g.13128723G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0365 | |||||
Flanking_sequences | tctaccatttgctctgataagacaggaact | tcacccaaaacagaatgactgtcgctcaca | |||||||
Mapping_target | B0365 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031996 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005464 | ||||||||
WBStrain00005507 | |||||||||
WBStrain00054586 | |||||||||
Laboratory | DA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001137 | |||||||
Transcript | B0365.3.2 (12) | ||||||||
B0365.3.1 (12) | |||||||||
Interactor | WBInteraction000503690 | ||||||||
WBInteraction000503691 | |||||||||
WBInteraction000518921 | |||||||||
WBInteraction000541752 | |||||||||
WBInteraction000541753 | |||||||||
Genetics | Interpolated_map_position | V | 4.93809 | ||||||
Mapping_data | In_2_point | 5213 | |||||||
In_multi_point | 1837 | ||||||||
1839 | |||||||||
1840 | |||||||||
1841 | |||||||||
2403 | |||||||||
2404 | |||||||||
In_pos_neg_data | 5212 | ||||||||
5214 | |||||||||
5215 | |||||||||
7050 | |||||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | eat-6(ad467) mutants were paralzyed faster than wild-type animals; however, aldicarb hypersensitivity was milder than that of the eat-6(ad601) animals. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 25 young-adult animals were placed on an agar plate containing 1 mM aldicarb. Paralysis was examined by probing the animals with a thin glass picker every 10 min. The animals were defined as 'paralyzed' if they showed no body-bending across the midline (see Doi and Iwasaki, 2002). | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited the strongest pumping defect compared to ad601 and ad997. Pump-dead EAT-6 did not rescue this pharyngeal pumping defect. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were measured for number of pharyngeal pumps in 30 sec (n=12). | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000124 | Paper_evidence | WBPaper00003150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Membrane associated Na, K -ATPase from the mutant showed significantly lower overall activity than that of WT although there were no significant kinetic differences between the two. | Paper_evidence | WBPaper00003150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited the strongest brood size defect compared to ad601 and ad997. Pump-dead EAT-6 did not rescue this brood size defect. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000330 | Paper_evidence | WBPaper00001709 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Strong relaxation defective. Corpus and terminal bulb motions are abnormal | Paper_evidence | WBPaper00001709 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Strong relaxation-defective. Pharynx oftens fails to relax, or relaxes slowly. There are long yawns, where the corpus stays open for seconds, punctuated with erratic partial relaxations. The terminal bulb is usually more strongly affected than the corpus, but the motions of the two are precisely synchronized. Relaxation transient is reduced in size in electropharyngeograms. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001709 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000332 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Hypersensitive to inhibitors of Na/K ATPase. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited paralysis sooner than wild-type animals but not as fast as eat-6(ad601) animals. Sensitivity was restored by EAT-6(D409E), a pump-dead Na+/K+ ATPase. Muscle specific expression, but not pan-neuronal or cholinergic motor-neuron expression, of EAT-6 fully rescued levamisole hypersensitivity. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 25 young-adult animals were placed on an agar plate containing 100 M levamisole. Paralysis was examined by probing the animals with a thin glass picker every 10 min. The animals were defined as 'paralyzed' if they showed no body-bending across the midline (see Doi and Iwasaki, 2002). | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | pDK43(pmyo-3::eat-6cDNA) or pDK70(punc-4::eat-6cDNA) or pDK69(punc-119::eat-6cDNA) | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed substantially decreased intracellular localization of UNC-29::GFP fusion protein with strong accumulation at the NMJ, significantly different to the pattern observed in eat-6(ad997) and wild-type animals. The localization pattern of the ACR-16 receptor was also altered; more GFP puncta were mislocalized to the trunks of the muscle arms compared to the wild-type pattern.The percentage of muscle arms containing extrasynaptic GFP puncta and the number of extrasynpatic puncta/muscle arm are increased compared to wild type. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Is[Pmyo-3::UNC-29::GFP] | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000547 | Paper_evidence | WBPaper00001709 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00001709 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Slightly dumpy | Paper_evidence | WBPaper00001709 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000656 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are defective in both nAChR localization and cholinergic transmission. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000964 | Paper_evidence | WBPaper00027611 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00000896 | Paper_evidence | WBPaper00027611 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001202 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited paralysis sooner than wild-type animals but not as fast as eat-6(ad601) animals. Sensitivity was restored by EAT-6(D409E), a pump-dead Na+/K+ ATPase. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001980 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 25 young-adult animals were placed on an agar plate containing 10 mM nicotine. Paralysis was examined by probing the animals with a thin glass picker every 10 min. The animals were defined as 'paralyzed' if they showed no body-bending across the midline (see Doi and Iwasaki, 2002). | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00059550 | |||||||
Curator_confirmed | WBPerson2181 | ||||||||
WBPhenotype:0001382 | Paper_evidence | WBPaper00003150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant animals exhibited fewer phosphorylated intermediates than wild-type animals. | Paper_evidence | WBPaper00003150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001409 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ACR-16::GFP puncta were mislocalized to the trunks of the muscle arms. The percentage of muscle arms containing extrasynaptic GFP puncta and the number of extrasynaptic puncta/muscle arm were increased compared to wild type. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | pMD906 (Pmyo-3::ACR-16::GFP) | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000655 | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals responded like wild type to GABA agonist muscimol (data not shown) | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003906 | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were treated with muscimol. | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00003150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant animals did not exhibit a difference in Na, K-ATPase mRNA levels or size. | Paper_evidence | WBPaper00003150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001321 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No gross differences were observed in the pan-neuronal or GABAergic pattern or expression levels of synaptic vesicle protein SNB-1::GFP compared to wild type. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005829 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | jsIs1 (Psnb-1::SNB-1::GFP) or juIs1 (Punc-25::SNB-1::GFP) | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001599 | Paper_evidence | WBPaper00003150 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Isolated Na, K -ATPase from the mutant showed similar kinetics and sensitivity to Oubain as enzyme isolated from WT worms. | Paper_evidence | WBPaper00003150 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001685 | Paper_evidence | WBPaper00031996 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Expression of membrane inserted LEV-1 receptors was not significantly different to that observed in wild-type animals. GABA receptor localization and expression was not affected. | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006804 | PATO:0000460 | Paper_evidence | WBPaper00031996 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For assaying LEV-1 protein localization, animals were injected with fluorescently-labeled anti-HA antibodies into the body cavity (Gottschalk et al., 2005; Gottschalk and Schafer, 2006) and were observed 6 hours later. | Paper_evidence | WBPaper00031996 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Is[Pmyo-3::UNC-29::GFP] or LEV::3xHA or oxIs22(Punc-49::UNC-49B::GFP) | Paper_evidence | WBPaper00031996 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00014520 | ||||||||
WBPaper00015075 | |||||||||
WBPaper00027611 | |||||||||
WBPaper00031996 | |||||||||
WBPaper00001709 | |||||||||
WBPaper00003150 | |||||||||
WBPaper00050508 | |||||||||
WBPaper00059550 | |||||||||
Method | Substitution_allele |