WormBase Tree Display for Transgene: WBTransgene00018796
expand all nodes | collapse all nodes | view schema
| WBTransgene00018796 | Public_name | WBPaper00042543Ex1 | |
|---|---|---|---|
| Summary | [Pcyc-2.1::GFP; Punc-122::GFP] | ||
| Synonym | Expr11086_Ex | ||
| Construction | Construct | WBCnstr00018157 | |
| Coinjection | WBCnstr00005331 | ||
| Construction_summary | Clone = pJG03. Approximately 1 kb upstream of the ATG start codon of cyc-2.1 were amplified by PCR (Forward primer, AATTGTCGACCCACTTCGCCTAAGTTGCGG; Reverse primer, AATTACCGGTGTTGAACCCTTAAAATACAG). This fragment containing the putative endogenous promoter of the cyc-2.1 gene was cloned upstream of the GFP encoding sequence in pPD95.75 (kindly provided by A. Fire, Stanford University School of Medicine), resulting in plasmid pJG03. --precise ends. | ||
| Genetic_information | Extrachromosomal | ||
| Used_for | Expr_pattern | Expr11086 | |
| Reference | WBPaper00042543 | ||
| Species | Caenorhabditis elegans |
