Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Transgene: WBTransgene00006334

expand all nodes | collapse all nodes | view schema

Name Class

WBTransgene00006334Public_nameatEx35
Summary[pCG9-3(nhr-25::gfp)]
ConstructionConstructWBCnstr00006182
Construction_summaryThe translational fusion, pCG9-3 is an independent isolate of pCG9 a construct that should permit utilization of both 5' ends of nhr-25::gfp. pCG9 was generated in the vector pPD95.67 (gift from A. Fire) by a PCR protocol (Cassata et al., 1998) employing the internal primer MK-1 (5'-[CCAATCCCGGGGATCCTCTAG]GCGTTT- GAAGAAGCCCTGTA-3'; GFP vector sequences bracketed) and the upstream primer MK-2 (5'-[CTTATCGCATGC]AGATGGCA- GAAGTGGGTGAC-3'; bracketed sequences provide a SphI restriction site).
Genetic_informationExtrachromosomal
Reference (2)
SpeciesCaenorhabditis elegans