WormBase Tree Display for Transgene: WBTransgene00006333
expand all nodes | collapse all nodes | view schema
| WBTransgene00006333 | Public_name | atEx32 | |
|---|---|---|---|
| Summary | [pCG9-2(nhr-25::gfp)] | ||
| Construction | Construct | WBCnstr00006181 | |
| Construction_summary | The translational fusion, pCG9-2 is an independent isolate of pCG9 a construct that should permit utilization of both 5' ends of nhr-25::gfp. pCG9 was generated in the vector pPD95.67 (gift from A. Fire) by a PCR protocol (Cassata et al., 1998) employing the internal primer MK-1 (5'-[CCAATCCCGGGGATCCTCTAG]GCGTTT- GAAGAAGCCCTGTA-3'; GFP vector sequences bracketed) and the upstream primer MK-2 (5'-[CTTATCGCATGC]AGATGGCA- GAAGTGGGTGAC-3'; bracketed sequences provide a SphI restriction site). | ||
| Genetic_information | Extrachromosomal | ||
| Reference | WBPaper00004124 | ||
| WBPaper00004742 | |||
| Species | Caenorhabditis elegans |
