WormBase Tree Display for Transgene: WBTransgene00005238
expand all nodes | collapse all nodes | view schema
| WBTransgene00005238 | Public_name | zuIs145 | |
|---|---|---|---|
| Summary | [unc-119(+) + nmy-2::MOM-5::GFP] | ||
| Synonym | [nmy-2::mom-5::gfp] | ||
| Construction | Construct | WBCnstr00005215 | |
| Integration_method | Gamma_irradiation | ||
| Construction_summary | A full-length mom-5 cDNA was isolated from adultC. elegans RNA by RT-PCR and fused to the nmy-2 promoter and to the gene encoding GFP as follows: nmy-2/linker/5$(B!l(B mom-5: gcggtaataatgggcgcgccacatcgacat and 3$(B!l(B mom-5/linker/gfp: aatatgaggggaggaagtggtcctgcaggaggtatgagtaaa. Strains expressing MOM-5::GFP were obtained by microparticle bombardment of unc-119 worms and extrachromosomal arrays were integrated by gamma-irradiation. | ||
| Genetic_information | Integrated | ||
| Used_for | Expr_pattern | Expr12892 | |
| Associated_with | Strain | WBStrain00022504 | |
| Reference | WBPaper00024672 | ||
| WBPaper00046716 | |||
| WBPaper00055870 | |||
| WBPaper00059401 | |||
| Species | Caenorhabditis elegans |
