WormBase Tree Display for Transgene: WBTransgene00005216
expand all nodes | collapse all nodes | view schema
| WBTransgene00005216 | Public_name | zhIs13 | |
|---|---|---|---|
| Summary | [eps-8::nls-gfp] | ||
| Construction | Construct | WBCnstr00005193 | |
| Construction_summary | The eps-8p::nls::gfp transcriptional reporter was generated by PCR amplification of a genomic fragment containing 2.4 kb of 5' promoter sequence and 18 bp of the open reading frame using the primers (CTCGAGTAACGTCAGAGATGTGC and GGATCCACCTCGAC GCATC) and cloned into the SalI and BamHI sites of pPD95.69 expression vector. --precise ends. | ||
| Genetic_information | Integrated | ||
| Used_for | Expr_pattern | Expr4383 | |
| Reference | WBPaper00027626 | ||
| Species | Caenorhabditis elegans |
