WormBase Tree Display for Transgene: WBTransgene00005161
expand all nodes | collapse all nodes | view schema
| WBTransgene00005161 | Public_name | ynIs64 | |
|---|---|---|---|
| Summary | [flp-17p::GFP] | ||
| Synonym | [flp-17::gfp] | ||
| Construction | Construct | WBCnstr00005138 | |
| Integration_method | UV | ||
| Construction_summary | C. elegans genomic DNA was used as template. Primers used are: FLP274 CTGGAAAAATAAAGTTTTGCG and FLP293 CCTTGAAGCTTTTCCTCTG. PCR products were digested with BamHI/SphI, inserted into vector pCR-Blunt digested with BamHI/SphI. --precise ends. | ||
| Genetic_information | Integrated | ||
| Map | I | ||
| Used_for | Expr_pattern | Expr3016 | |
| Expr3033 | |||
| Interactor | WBInteraction000534779 | ||
| Associated_with | Strain | WBStrain00029165 | |
| Reference (14) | |||
| Species | Caenorhabditis elegans |
