WormBase Tree Display for Transgene: WBTransgene00005147
expand all nodes | collapse all nodes | view schema
| WBTransgene00005147 | Public_name | ynIs37 | |
|---|---|---|---|
| Summary | [flp-13p::GFP] | ||
| Synonym | [Pflp-13::gfp] | ||
| Construction | Construct | WBCnstr00005124 | |
| Integration_method | UV | ||
| Construction_summary | C. elegans genomic DNA was used as template. Primers used are: FLP164 GCAGTGACGTCATCTTGTTCG and FLP157 AAATTGTGCCTCCTGATGCTG. PCR products were digested with BamHI/SphI, inserted into vector pCR-Blunt digested with BamHI/SphI. --precise ends. | ||
| Genetic_information | Integrated | ||
| Map | III | ||
| Used_for | Expr_pattern | Expr3014 | |
| Expr7935 | |||
| Associated_with | Strain | WBStrain00029158 | |
| WBStrain00050768 | |||
| WBStrain00044273 | |||
| Reference (16) | |||
| Species | Caenorhabditis elegans |
