WormBase Tree Display for Transgene: WBTransgene00004935
expand all nodes | collapse all nodes | view schema
| WBTransgene00004935 | Public_name | WBPaper00027055Is1 | |
|---|---|---|---|
| Summary | [myo-3::unc-9(cDNA)] | ||
| Construction | Construct | WBCnstr00004912 | |
| Integration_method | Gamma_irradiation | ||
| Laboratory | ZW | ||
| Construction_summary | The unc-9 cDNA was amplified from a first-strand cDNA library by nested PCR using two pairs of primers (outer sense: CCAGTTGTGGACTCGAAATCAA; outer antisense: CGACTACACCCATTGACGACAA; inner sense: GAGGATCCAGGATGAGTATGCTATTGTATT; and inner antisense: GAACCGGTAACACGTCGTGCATTTTTCCT). The inner primers contained AgeI and BamHI sites for insertion of the unc-9 cDNA into a vector (pPD118.20). The cloned unc-9 cDNA was completely sequenced. The rescuing plasmid was injected into the syncytial gonad of unc-9(fc16) hermaphrodites. A plasmid for muscle-specific GFP expression (pPD118.20) was co-injected to serve as a transformation marker. The transgene was integrated by {gamma}-irradiation followed by backcrossing three times. | ||
| Genetic_information | Integrated | ||
| Reference | WBPaper00027055 | ||
| Species | Caenorhabditis elegans |
