WormBase Tree Display for Transgene: WBTransgene00001648
expand all nodes | collapse all nodes | view schema
| WBTransgene00001648 | Public_name | oxIs92 | |
|---|---|---|---|
| Summary | [unc-26::gfp] | ||
| Construction | Construct | WBCnstr00001637 | |
| Integration_method | X-ray | ||
| Construction_summary | translational fusion. The UNC-26:GFP fusion pKS32 is driven by the neuron-specific rab-3 promoter using a PstI fragment. pKS32 was injected into unc-26(s1710); lin-15(n765ts) worms at a concentration of 7 ng/ul along with EK L15 (50 ng/ul) and 1 kb ladder (45 ng/ul) to generate oxEx475. The strain EG3000 containing oxEx475 was irradiated with 4000 Rads of X-ray to obtain an integrated array oxIs92[GFP-UNC-26; lin-15(+)].|A NotI site was created in pPD95.67 (pPD95.67NotI) by PCR amplifying GFP using GFP 5 : GAAGAAGCGTAAGGTACCGGTAG and GFPNot: GAATTCGCGGCCGCTTTGTATAGTTCATCCATGCCATG. The unc-26 cDNA, yk453b7 was used as template in order to create NotI sites on either side of the unc-26 sequence, u26NotI: GCGGCCGCTATGTCAGTTCGAGGGATTCGG and u26Not2: GCGGCCGCTCTACATATTTTTTGGTCTAGGTGG, and was cloned into the NotI site of the vector pPD95.67NotI. --precise ends. | ||
| Genetic_information | Integrated | ||
| Used_for | Expr_pattern | Expr2771 | |
| Reference | WBPaper00006213 | ||
| WBPaper00040320 | |||
| Species | Caenorhabditis elegans |
