WormBase Tree Display for Transgene: WBTransgene00001486
expand all nodes | collapse all nodes | view schema
WBTransgene00001486 | Public_name | otEx1779 | |
---|---|---|---|
Summary | [lsy-2::gfp; rol-6(d)] | ||
Construction | Construct | WBCnstr00001476 | |
Construction_summary | A lsy-2::gfp reporter gene fusion in which the coding region for green fluorescent protein was fused to the lsy-2 locus, including the full-coding region and its complete 5' region to the next gene. lsy-2prom::gfp was generated by fusing 3 kb upstream (up to the preceding gene) of the lsy-2 gene to the gfp-coding region. The construct was injected at 50 ng/ul together with rol-6(d) as an injection marker (100 ng/l). lsy-2::gfp was generated by fusing 3 kb of the upstream region and the all of the exons and introns of lsy-2 to the gfp-coding region and the unc-54 3'UTR. The construct was injected at 5 ng/ul together with rol-6(d) as an injection marker (100 ng/l). Primer sequences (5' to 3') lsy-2prom::gfp: Primer A, GTTGAATCCGACTTCTTCAGGG; Primer A*, GTTTCTAGCAATCTGGTTGTTG; Primer B, CTAGAGTCGACCTGCAGGCCATGACAAAATTTGCCTCAGAC; Primer C, AGCTTGCATGCCTGCAGGTCGACT; Primer D, AAGGGCCCGTACGGCCGACTA; Primer D*, GGAAACAGTTATGTTTGGTATATTGGG. lsy-2::gfp Primer A, GTTGAATCCGACTTCTTCAGGG; Primer A*, GTTTCTAGCAATCTGGTTGTTG; Primer B, CTAGAGTCGACCTGCAGGCAATCAACTGTGGTTCCATCATC; Primer C, D and D*, as above. --precise ends. | ||
Genetic_information | Extrachromosomal | ||
Used_for | Expr_pattern | Expr3799 | |
Reference | WBPaper00027031 | ||
Species | Caenorhabditis elegans |