Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Transgene: WBTransgene00001481

expand all nodes | collapse all nodes | view schema

Name Class

WBTransgene00001481Public_nameotEx1326
Summary[lsy-2::gfp; rol-6(d)]
ConstructionConstructWBCnstr00001471
Construction_summaryA lsy-2::gfp reporter gene fusion in which the coding region for green fluorescent protein was fused to the lsy-2 locus, including the full-coding region and its complete 5' region to the next gene. lsy-2prom::gfp was generated by fusing 3 kb upstream (up to the preceding gene) of the lsy-2 gene to the gfp-coding region. The construct was injected at 50 ng/ul together with rol-6(d) as an injection marker (100 ng/l). lsy-2::gfp was generated by fusing 3 kb of the upstream region and the all of the exons and introns of lsy-2 to the gfp-coding region and the unc-54 3'UTR. The construct was injected at 5 ng/ul together with rol-6(d) as an injection marker (100 ng/l). Primer sequences (5' to 3') lsy-2prom::gfp: Primer A, GTTGAATCCGACTTCTTCAGGG; Primer A*, GTTTCTAGCAATCTGGTTGTTG; Primer B, CTAGAGTCGACCTGCAGGCCATGACAAAATTTGCCTCAGAC; Primer C, AGCTTGCATGCCTGCAGGTCGACT; Primer D, AAGGGCCCGTACGGCCGACTA; Primer D*, GGAAACAGTTATGTTTGGTATATTGGG. lsy-2::gfp Primer A, GTTGAATCCGACTTCTTCAGGG; Primer A*, GTTTCTAGCAATCTGGTTGTTG; Primer B, CTAGAGTCGACCTGCAGGCAATCAACTGTGGTTCCATCATC; Primer C, D and D*, as above. --precise ends.
Genetic_informationExtrachromosomal
Used_forExpr_patternExpr3799
ReferenceWBPaper00027031
SpeciesCaenorhabditis elegans