WormBase Tree Display for Transgene: WBTransgene00000359
expand all nodes | collapse all nodes | view schema
| WBTransgene00000359 | Public_name | chIs1200 | |
|---|---|---|---|
| Summary | [ceh-26::gfp + dpy-20(+)] | ||
| Construction | Construct | WBCnstr00000359 | |
| Coinjection_other | dpy-20 | ||
| Construction_summary | Clone = pRFP7. A 6.4 kb fragment of ceh-26 containing 5277 bp 5' flanking sequence plus coding sequence to the fourth exon was amplified by long-range PCR using primers P26-22 (GTCCTTTGGCCAATCCCGGGGATCCAGAGCTACTGTTACTTTCAGGGC) and P26-23 (GCCTGCAGAACATTGGCATGTGGCGTCACGGG). BamHI-digested pPD95.77 was joined to the ceh-26 fragment by primer extension and linear amplification. The product was cut with PstI and circularized to give plasmid pRFP7. --precise ends. | ||
| Genetic_information | Integrated | ||
| Map | III | ||
| Used_for | Expr_pattern | Expr2696 | |
| Expr1170049 | |||
| Associated_with | Strain | WBStrain00034658 | |
| Reference | WBPaper00006247 | ||
| WBPaper00036277 | |||
| WBPaper00037652 | |||
| WBPaper00045644 | |||
| Species | Caenorhabditis elegans |
