WormBase Tree Display for Strain: WBStrain00055456
expand all nodes | collapse all nodes | view schema
| WBStrain00055456 | Genotype | C15H9.4(ve808[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC30 [ubc-17(tmIs1243)] X. | ||
|---|---|---|---|---|
| Public_name | RG3308 | |||
| Contains | Gene | WBGene00003514 | ||
| WBGene00004496 | ||||
| WBGene00006712 | ||||
| WBGene00006789 | ||||
| Rearrangement | tmC30 | |||
| Transgene | WBTransgene00024758 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 31 Oct 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous animals may be sensitive to starvation (grotty, low brood size). Deletion of 1634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, wild-type GFP+ non-mCherry (ve808 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+.Left flanking Sequence: TACTATATTCTGTTATTCCAAAATGCGTTT ; Right flanking sequence: ATAATGTGAACAGCACGCAAAACGGAACAA. sgRNA #1: GTTCCAGATGACAACAGACT; sgRNA #2: TGTCAAATCAGCTTTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: RG KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
