WormBase Tree Display for Strain: WBStrain00055439
expand all nodes | collapse all nodes | view schema
| WBStrain00055439 | Genotype | rnp-6(ve790[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC20 [dpy-5(tm9709)] I. | ||
|---|---|---|---|---|
| Public_name | RG3290 | |||
| Contains | Gene | WBGene00001067 | ||
| WBGene00003514 | ||||
| WBGene00004389 | ||||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| Variation | WBVar02148981 | |||
| Rearrangement | tmC20 | |||
| Properties | Outcrossed | x6 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 20 Jun 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | Early larval arrest. Deletion of 7256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain KR16. unc-11 dpy-5 homozygotes no longer carrying the duplication were outcrossed 5 times to N2 to remove dpy-5; however, unc-11 may still be in the background. rnp-6 deletion was balanced over tmC20 [dpy-5(tm9709)] by crossing with strain FX30235. Balanced heterozygotes are semi-Dpy GFP+, and segregate semi-Dpy GFP+, early larval lethal GFP+ (ve790 homozygotes), and non-GFP dpy-5 animals (tmC20 homozygotes). Maintain by picking semi-dpy GFP+. Left flanking Sequence: attaaaaacatggaggaattcgagaataca ; Right flanking sequence: GCCTGTTTTCGATGTCTGCCGAGTTTTCTT. sgRNA #4: TGGAAATACTGTCAAAGCGG; sgRNA #2: AGACATCGAAAACAGGCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: RG KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
