WormBase Tree Display for Strain: WBStrain00055352
expand all nodes | collapse all nodes | view schema
| WBStrain00055352 | Genotype | asp-12(sy1899) V. | ||
|---|---|---|---|---|
| Public_name | PS9705 | |||
| Contains | Gene | WBGene00017678 | ||
| Variation | WBVar02159092 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 02 Aug 2023 00:00:00 | |||
| Location | CGC | |||
| Remark | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of asp-12. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAATCGCCAAAGATGCAAATGATGAGGCGAGGAGA. Right flanking sequence: ATGGGGAGCATACGTTCAACACAAGGCTGCCCTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGATGAGGCGAGGAGAATG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. | Inferred_automatically | From CGC strain data | |
| Made_by: Heenam Park | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
