WormBase Tree Display for Strain: WBStrain00055308
expand all nodes | collapse all nodes | view schema
WBStrain00055308 | Genotype | col-131(sy1765) IV. | ||
---|---|---|---|---|
Public_name | PS9419 | |||
Contains | Gene | WBGene00000705 | ||
Variation | WBVar02159068 | |||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 15 Jun 2022 00:00:00 | |||
Location | CGC | |||
Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-131. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCTTTCGGTGCTGGTATTTGTCCTTCAGACCAAGA right flanking sequence: ATGATTTGGACCAAGTTTGGGCCGAGTTTGATCAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTTGGTCCAAATCATTCT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616 | Inferred_automatically | From CGC strain data | |
Made_by: Heenam Park | CGC_data_submission | |||
Species | Caenorhabditis elegans |