WormBase Tree Display for Strain: WBStrain00055119
expand all nodes | collapse all nodes | view schema
| WBStrain00055119 | Genotype | pah-1(syb3601) II. | ||
|---|---|---|---|---|
| Public_name | PHX3601 | |||
| Contains | Gene | WBGene00000240 | ||
| Properties | Outcrossed | x0 | ||
| CGC_received | 25 May 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT. | Inferred_automatically | From CGC strain data | |
| Made_by: Frank Schroeder via SUNY Biotech | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
