WormBase Tree Display for Strain: WBStrain00055022
expand all nodes | collapse all nodes | view schema
| WBStrain00055022 | Genotype | unc-86(ot1158)III. | |
|---|---|---|---|
| Public_name | OH17241 | ||
| Contains | Gene | WBGene00006818 | |
| Variation | WBVar02159029 | ||
| Properties | Outcrossed | x2 | |
| Mutagen | CRISPR_Cas9 | ||
| CGC_received | 25 Aug 2022 00:00:00 | ||
| Location | CGC | ||
| Remark | unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https: | ||
| Made_by: Tessa Tekieli | CGC_data_submission | ||
| Species | Caenorhabditis elegans |
