WormBase Tree Display for Strain: WBStrain00051696
expand all nodes | collapse all nodes | view schema
| WBStrain00051696 | Status | Live | ||
|---|---|---|---|---|
| Genotype | asp-3(utx47[mNG::3xFlag::asp-3]) X. | |||
| Public_name | GLW57 | |||
| Contains | Gene | WBGene00000216 | ||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 27 Apr 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58. | Inferred_automatically | From CGC strain data | |
| Made_by: Stephen Pullman (Glow Worms '21) | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
