WormBase Tree Display for Strain: WBStrain00050922
expand all nodes | collapse all nodes | view schema
| WBStrain00050922 | Status | Live | ||
|---|---|---|---|---|
| Genotype | oac-51(sy1388) IV. | |||
| Public_name | PS8536 | |||
| Contains | Gene | WBGene00020976 | ||
| Variation | WBVar02157427 | |||
| Properties | Outcrossed | xNo | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 19 Oct 2020 00:00:00 | |||
| Location | CGC | |||
| Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-51. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: gatttaataatttaggcATGGTAGTTTACACCGCTright flanking sequence: CTGTGGAACATTGAAGATCAAAATAAGCAATTTAAAAACinserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGGTAGTTTACACCGCTCTGMethod Reference: G3 (Bethesda). | Inferred_automatically | From CGC strain data | |
| Made_by: Heenam Park | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
