WormBase Tree Display for Strain: WBStrain00049427

WBStrain00049427 Evidence: Curator_confirmed: WBPerson1983
  Status: Live
  Genotype: Y45F10D.7(ve688[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V.
  Public_name: RG3188
  Contains: Gene: WBGene00003514
      WBGene00004496
      WBGene00006789
    Variation: WBVar02154246
    Rearrangement: nT1
    Transgene: WBTransgene00033215
  Properties: Outcrossed: x0
    Mutagen: CRISPR_Cas9
    CGC_received: 16 Mar 2021 00:00:00
  Location: CGC
  Remark: umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 6878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve688 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tctcatttttcagctttttcagcttttcca ; Right flanking sequence: GAAGGAGCATCGGAGCATGAAGAGCTCACA. sgRNA #1: gcaaATGAAGCGCATCCAGT; sgRNA #2: ATTATGTGGAATGCATCAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
    umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 6878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve688 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Inferred_automatically: From CGC strain data
    Made_by: RG KO Group CGC_data_submission
  Species: Caenorhabditis elegans