WormBase Tree Display for Strain: WBStrain00047682
expand all nodes | collapse all nodes | view schema
WBStrain00047682 | Status | Live | ||
---|---|---|---|---|
Genotype | C34C12.8(gk5529[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. | |||
Public_name | VC4454 | |||
Contains | Gene | WBGene00003514 | ||
WBGene00004496 | ||||
WBGene00006789 | ||||
Variation | WBVar02153755 | |||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 05 Nov 2019 00:00:00 | |||
Location | CGC | |||
Remark | Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1132 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AGACACGCACGAAAATCACGCCAGCACGTT; Right flanking sequence: GTTGGAGTCGTCTCTAAATAATTTTCTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Made_by: Vancouver KO Group | CGC_data_submission | |||
Species | Caenorhabditis elegans |