WormBase Tree Display for Strain: WBStrain00047660
expand all nodes | collapse all nodes | view schema
| WBStrain00047660 | Status | Live | ||
|---|---|---|---|---|
| Genotype | F28D9.4(gk5478[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | |||
| Public_name | VC4400 | |||
| Contains | Gene | WBGene00003514 | ||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| Variation | WBVar02153733 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 05 Nov 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | Made_by: Vancouver KO Group | CGC_data_submission | ||
| [NOTE: Please see RG5019 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2626 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTTTACCTATTGCTTTTGCTCTGTAGTA; Right flanking sequence: GACGGTGTTGCTGCTGGGCTGCTGCTCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | ||
| Species | Caenorhabditis elegans |
