Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Strain: WBStrain00047545

expand all nodes | collapse all nodes | view schema

Name Class

WBStrain00047545StatusLive
Genotypersp-4(gk3722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Public_nameVC3764
Contains (2)
PropertiesOutcrossedx0
MutagenCRISPR_Cas9
CGC_received05 Nov 2019 00:00:00
LocationCGC
RemarkHomozygous viable. Deletion of 404 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCGCGTTTCTGTTAGCTATATTCAATTC; Right flanking sequence: TGGTGGTGGACGTAGAAGGTTAGTATACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.Inferred_automaticallyFrom CGC strain data
Made_by: Vancouver KO GroupCGC_data_submission
SpeciesCaenorhabditis elegans