WormBase Tree Display for Strain: WBStrain00047452
expand all nodes | collapse all nodes | view schema
| WBStrain00047452 | Evidence | Curator_confirmed | WBPerson1983 | |
|---|---|---|---|---|
| Status | Live | |||
| Genotype | C46G7.1(ve546[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. | |||
| Public_name | RG3046 | |||
| Contains | Gene | WBGene00003514 | ||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| Variation | WBVar02153996 | |||
| Rearrangement | nT1 | |||
| Transgene | WBTransgene00033215 | |||
| Properties | Mutagen | CRISPR_Cas9 | ||
| CGC_received | 12 Jun 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 1523 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, larval lethal GFP+ non-mKate2 (ve546 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatacaatttacaggtaaaagccggcaac ; Right flanking sequence: ATCGGAATTGCAGTTCTTCTTTCACTTCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: RG KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
