WormBase Tree Display for Strain: WBStrain00037923
expand all nodes | collapse all nodes | view schema
| WBStrain00037923 | Status | Live | ||
|---|---|---|---|---|
| Genotype | C36B7.3(gk5200) ent-2(gk5201) X. | |||
| Public_name | VC4121 | |||
| Contains | Gene | WBGene00010701 | ||
| WBGene00016466 | ||||
| Variation | WBVar02149885 | |||
| WBVar02149886 | ||||
| Properties | Outcrossed | x0 | ||
| Mutagen | EMS | |||
| CGC_received | 15 Mar 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5200 mutation is C->T, flanking sequences GAGAAACAAATATGCATTGAGTCACCGATT and AGAAGCGGCATCCAAGATCTTTTCATGATA. The gk5201 mutation is G->A, flanking sequences TCTTTTTTTCAACTAATCTACATACTTCCA and GGCTCACTGGATTTTTCACTCTTACCATCA. | Inferred_automatically | From CGC strain data | |
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
