WormBase Tree Display for Strain: WBStrain00037871
expand all nodes | collapse all nodes | view schema
| WBStrain00037871 | Status | Live | ||
|---|---|---|---|---|
| Genotype | F25H2.3(gk5066[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | |||
| Public_name | VC3994 | |||
| Contains | Gene | WBGene00003514 | ||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| Variation | WBVar02149179 | |||
| Transgene | WBTransgene00026057 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 26 Jun 2018 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous viable. Deletion of 1526 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCACAATTACGATCAGGTTTTATGTATG; Right flanking sequence: TATTTTTAGAGATCTTCAAACGAAGATCAG. See WormBase Variation gk5066 for details. | Inferred_automatically | From CGC strain data | |
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
