WormBase Tree Display for Strain: WBStrain00037827
expand all nodes | collapse all nodes | view schema
WBStrain00037827 | Status | Live | ||
---|---|---|---|---|
Genotype | +/nT1 IV; hmgs-1(gk3838[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V . | |||
Public_name | VC3874 | |||
Contains | Gene | WBGene00003514 | ||
WBGene00004496 | ||||
WBGene00006789 | ||||
WBGene00017769 | ||||
Variation | WBVar02149146 | |||
Rearrangement | nT1 | |||
Transgene | WBTransgene00026023 | |||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 26 Jun 2018 00:00:00 | |||
Location | CGC | |||
Remark | Recessive lethal deletion balanced by nT1. Deletion of 1177 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGCGACTTGACGAATTTTATCAAGATTA; Right flanking sequence: ATACGATGTCCTCGTTGTCCGAGCAGAATC. See WormBase Variation gk3838 for details. | Inferred_automatically | From CGC strain data | |
Made_by: Vancouver KO Group | CGC_data_submission | |||
Species | Caenorhabditis elegans |