WormBase Tree Display for Strain: WBStrain00037814

WBStrain00037814 Status: Live
  Genotype: pqn-82(gk3768[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III.
  Public_name: VC3801
  Contains: Gene: WBGene00003514
      WBGene00004163
      WBGene00004496
      WBGene00006789
    Variation: WBVar02148884
    Transgene: WBTransgene00026012
  Properties: Outcrossed: x0
    Mutagen: CRISPR_Cas9
    CGC_received: 26 Jun 2018 00:00:00
  Location: CGC
  Remark: Homozygous viable. Deletion of 886 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTACAGAAGTTTTAAGAAAACTGGGTCAAG; Right flanking sequence: AGGAGCAATTGGCTCAGCAGCATCACCAGC. See WormBase Variation gk3768 for details. Inferred_automatically: From CGC strain data
    Made_by: Vancouver KO Group CGC_data_submission
  Species: Caenorhabditis elegans