Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Strain: WBStrain00033340

expand all nodes | collapse all nodes | view schema

Name Class

WBStrain00033340EvidenceCurator_confirmedWBPerson1983
StatusLive
Genotypesra-22(ve513[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Public_nameRG3013
ContainsGeneWBGene00003514
WBGene00004496
WBGene00005048
WBGene00006789
VariationWBVar02153966
PropertiesMutagenCRISPR_Cas9
CGC_received26 Oct 2018 00:00:00
LocationCGC
RemarkSuperficially wild-type. CRISPR/Cas9 deletion of sra-22. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttaccgtcaacgctatcattaatttcatcc Right flanking sequence: gaaggcgaggcaagacgatttttctgttttInferred_automaticallyFrom CGC strain data
Made_by: Emily Lorenz-MuellerCGC_data_submission
Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.Inferred_automaticallyFrom CGC strain data
Made_by: RG KO GroupCGC_data_submission
Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SpeciesCaenorhabditis elegans