WormBase Tree Display for Strain: WBStrain00033330
expand all nodes | collapse all nodes | view schema
WBStrain00033330 | Evidence | Curator_confirmed | WBPerson1983 | |
---|---|---|---|---|
Status | Live | |||
Genotype | sra-34(ve500[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | |||
Public_name | RG3000 | |||
Contains | Gene | WBGene00003514 | ||
WBGene00004496 | ||||
WBGene00005060 | ||||
WBGene00006789 | ||||
Variation | WBVar02153957 | |||
Properties | Mutagen | CRISPR_Cas9 | ||
CGC_received | 25 Aug 2018 00:00:00 | |||
Location | CGC | |||
Made_by | WBPerson14989 | |||
Remark | Superficially wild-type. CRISPR/Cas9 deletion of sra-34. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: GAATTAATACAAACAACAGGAGCTGGAACA Right flanking sequence: gaaggtattgaataaaacgcggaagttcta | Inferred_automatically | From CGC strain data | |
Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | ||
Made_by: RG KO Group | CGC_data_submission | |||
Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | ||||
Species | Caenorhabditis elegans |