WormBase Tree Display for Strain: WBStrain00031018
expand all nodes | collapse all nodes | view schema
| WBStrain00031018 | Evidence | Paper_evidence | WBPaper00055300 | |
|---|---|---|---|---|
| Status | Live | |||
| Genotype | clik-1(sy1084) V. | |||
| Public_name | PS7778 | |||
| Contains | Gene | WBGene00020808 | ||
| Variation | WBVar02149209 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 13 Jun 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | |||
| Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcReference: Wang H, et al. G3 (Bethesda). | Inferred_automatically | From CGC strain data | ||
| Made_by: Heenam Park | CGC_data_submission | |||
| Reference | WBPaper00055300 | |||
| Species | Caenorhabditis elegans |
