WormBase Tree Display for Strain: WBStrain00029928
expand all nodes | collapse all nodes | view schema
| WBStrain00029928 | Status | Live | ||
|---|---|---|---|---|
| Genotype | unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. | |||
| Public_name | OH15227 | |||
| Contains | Gene | WBGene00006818 | ||
| Variation | WBVar02149077 | |||
| Properties | Outcrossed | x3 | ||
| CGC_received | 19 Feb 2018 00:00:00 | |||
| Location | CGC | |||
| Remark | unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press). | Inferred_automatically | From CGC strain data | |
| Made_by: Eduardo Leyva-Diaz | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
