WormBase Tree Display for RNAi: WBRNAi00110185
expand all nodes | collapse all nodes | view schema
| WBRNAi00110185 | Homol | Homol_homol | Y37E3:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGACTCGTGGAAATCAAAGAGATCTGGCTCGTGAGAAGAACCAAAAGAAACTGGCCGATCAAAAGAAGCGCCAGGGAGCCTCTGGACAAGACGGAAATGCTGGTCTATCGATGGATGCTCGCATGAATCGCGACGCTGACGTCATGCGTATCAAGCAGGAGAAAGCGGCAGCCAAGAAAGAAGCCGAAGCCGCTGCAGCTGCTGCAAACGCAAAGAAGGTCGCCAAAGTGGACCCATTGAAGATGTGA | |||
| Experiment | Strain | WBStrain00000183 | |||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | Y37E3.4 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00021348 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y37E3.4.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00037072 | ||||
| Phenotype | WBPhenotype:0001405 | Remark | RNAi of moag-4 suppresses the formation of polyglutamine aggregates. | ||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
