WormBase Tree Display for RNAi: WBRNAi00102843

WBRNAi00102843 Homol: Homol_homol: K10C3:RNAi
  Sequence_info: DNA_text: ATGGACCTAGTAGATCCTCTTGCGGAACCATGTGCCGTTTGTGGTGACAAATCAACTGGAACCCATTATGGAGTCATTTCCTGCAACGGGTGTAAGGGATTCTTCCGCCGAACAGTTCTTCGTGATCAGAAGTTCACTTGCCGTTTCAACAAAAGATGTGTGATTGACAAAAACTTTCGATGCGCGTGTCGTTATTGTCGCTTTCAAAAGTGTGTACAAGTTGGAATGAAACGAGAAGCTATTCAATTCGAACGTGATCCTGTAGGTTCACCAACATCTGGAGCCAGTCTCAACGGGACTCCATTCAAAAAAGACAGAAGCCCCGGATACGAGAACGGAAACAGCAACGGTGTCGGATCAAACGGTATGGGACAAGAGAATATGCGAACAGTTCCACAATCCAGCAGTGTCATTGATGCTTTAATGGAGATGGAGGCTCGTGTCAATCAAGAGATGTGTAATCGATACCGAAGATCGCAAATCTTTGCAAACGGCAGTGGGGGGTCGAATGGAAATGACACAGATATTCAACAAGGAAGTGATTCTGGAGCATCGGCATTTGCACCACCAAACCGGCCATGCACAACCGAGGTAGATCTGAATGAAATCTCCAGGACAACACTTTTATTGATGGTTGAATGGGCAAAAACAATTAATCCATTCATGGATCTTTCGATGGAAGATAAGATCATTCTACTGAAAAACTATGCACCACAACATCTCATTTTGATGCCAGCATTTCGAAGTCCCGATACAACTCGAGTTTGTCTCTTCAACAATACTTATATGACACGTGACAATAACACTGACCTCAATGGATTTGCTGCATTCAAAACAAGCAATATAACACCCAGAGTTCTTGATGAAATTGTCTGGCCAATGCGACAACTTCAGATGAGAGAACAAGAATTTGTATGTTTGAAAGCACTTGCATTCTTGCACCCAGAAGCCAAAGGACTCTCGAATAGCTCACAGATTATGATTCGTGATGCTAGAAATCGTGTTTTGAAAGCTCTTTATGCATTCATTCTCGATCAGATGCCAGATGACGCACCCACAAGATATGGAAATATTTTGTTGTTGGCACCGGCTCTCAAGGCTCTGACTCAGCTGCTCATTGAGAATATGACACTTACAAAGTTCTTCGGATTGGCAGAGGTGGATTCTCTGCTCTCCGAGTTCATTCTCGACGACATCAATGATCATTCGACGGCTCCGGTCTCTTTACAGCAACATCTTTCATCTCCGACAACGTTACCGACTAATGGGGTATCTCCGTTAAATCCAGCCGGATCAGTGGGAAGTGTTTCGTCTGTTTCTGGAATTACACCAACTGGAATGCTCTCAGCAACTCTTGCAGCTCCATTGGCAATTCATCCTCT
  Experiment: Date: 18 Sep 2013 00:00:00
    Treatment: HT115 bacteria containing an RNAi vector or control vector were grown in Luria-Bertani (LB) broth with 25 micrograms per milliliter carbenicillin overnight at 37 degrees Celsius, and induced with 1mM isopropyl-b-D-thiogalactopyranoside (IPTG) for the final 3 hours. The bacterial culture was pelleted and resuspended in the same volume of S-medium with added 1 mM IPTG and 25 micrograms per milliliter carbenicillin, and 500 microliters was dispensed into each well of a 24-well plate. Two synchronized L3 larval worms were added to each well. Plates were incubated at 20 degrees Celsius for 3 days, during which period the worms would have laid eggs that then hatched and grew to the L3 larval stage. Two-day-old worms were treated with the test compounds in 500 microliters of S-medium with fresh HT115 RNAi bacteria culture, 1 mM IPTG and 25 micrograms per milliliter carbenicillin per well. The plates were incubated at 20 degrees Celsius for 24 hours and RNAi worms that had been treated with the same test compound were combined (24-wells). Worms were washed in M9 1X buffer and subjected to the measurement of Oil Red O staining intensity, or protein or RNA extraction.
    Delivered_by: Bacterial_feeding
  Inhibits: Predicted_gene: K10C3.6a Inferred_automatically: RNAi_primary
      K10C3.6c Inferred_automatically: RNAi_primary
      K10C3.6b Inferred_automatically: RNAi_primary
      K10C3.6d Inferred_automatically: RNAi_primary
      K10C3.6e Inferred_automatically: RNAi_primary
    Gene: WBGene00003639 Inferred_automatically: RNAi_primary
    Transcript: K10C3.6a.1 Inferred_automatically: RNAi_primary
      K10C3.6d.1 Inferred_automatically: RNAi_primary
      K10C3.6e.1 Inferred_automatically: RNAi_primary
      K10C3.6a.2 Inferred_automatically: RNAi_primary
      K10C3.6c.1 Inferred_automatically: RNAi_primary
      K10C3.6b.1 Inferred_automatically: RNAi_primary
      K10C3.6b.2 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00044571
  Phenotype: WBPhenotype:0000137 Remark: nhr-49(RNAi) worms showed increased fat storage under Oil Red O staining (Fig. 6A and B, Supplemental Fig. 5). They showed a marked increase in body size and significantly lower expression of mitochondrial beta-oxidation genes, ech-1 (encodes a mitochondrial beta-oxidation trifunctional enzyme), cpt-5 (encodes a carnitine palmitoyl transferase), and acs-2 (encodes a mitochondrial acyl-CoA synthetase) (Fig. 6C).
    WBPhenotype:0000319 Remark: nhr-49(RNAi) worms showed increased fat storage under Oil Red O staining (Fig. 6A and B, Supplemental Fig. 5). They showed a marked increase in body size and significantly lower expression of mitochondrial beta-oxidation genes, ech-1 (encodes a mitochondrial beta-oxidation trifunctional enzyme), cpt-5 (encodes a carnitine palmitoyl transferase), and acs-2 (encodes a mitochondrial acyl-CoA synthetase) (Fig. 6C).
    WBPhenotype:0001184 Remark: nhr-49(RNAi) worms showed increased fat storage under Oil Red O staining (Fig. 6A and B, Supplemental Fig. 5). They showed a marked increase in body size and significantly lower expression of mitochondrial beta-oxidation genes, ech-1 (encodes a mitochondrial beta-oxidation trifunctional enzyme), cpt-5 (encodes a carnitine palmitoyl transferase), and acs-2 (encodes a mitochondrial acyl-CoA synthetase) (Fig. 6C).
  Remark: (Figure 6, S5) nhr-49 RNAi
  Method: RNAi