WormBase Tree Display for RNAi: WBRNAi00102166
expand all nodes | collapse all nodes | view schema
WBRNAi00102166 | Homol | Homol_homol | B0511:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | gcattgacgtcaagaagaaggtgctcaagcgaaagctgaaacagatgaaggatggacatgagaagaaaaaggctaaggaggttgtagttgaagaaccaatggaggaagaagatgaggaggaagtggaagaggagcaaaagcatcaaacggaggagtcaagtgaaaccaaagtgtctgagttcttgacgaagactacatttgcatcgcttgaaggaaaagttaacgcgaatttgctgaaagccgtacaaggattgggattcactacaatgacagaaattcaggcaaagagtattgatccgttgttggaggtagactttataacttttttctttttttaataagtttcaatttctcagggaaaagacgtattggcatcagcaaaaactggttctggaaagacgcttgccttcctgctccctgctatcgaacttcttcacaaactcaactggaaacaacacaatggaactggtgtcatcattgtgtctccaactcgtgaattgtcgatgcaaacttatggagttttgtccgaacttcttgaaggatccaatttgacgtatggattagtgatgggtgg | |||
Experiment | Laboratory | DJK | |||
Genotype | wdIs52 [F49H12.4::GFP + unc-119(+)]; sid-1(pk3321); uIs69 [Pmyo-2:::mCherry + Punc-119::sid-1] | ||||
Treatment | L4 hermaphrodites were placed on Petri plates with nematode growth medium seeded with dsRNA-expressing E. coli. The P0 worms were transferred to a new plate after 24 hours and the progeny from that second plate scored at the young adult stage. Animals carrying a GFP marker for PVD neurons were imaged and the number of dendritic termini counted on the dorsal and ventral sides from the cell body to the posterior end of the animal. | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | B0511.6 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00015232 | Inferred_automatically | RNAi_primary | ||
Transcript | B0511.6.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00046432 | ||||
Phenotype_not_observed | WBPhenotype:0000882 | Remark | RNAi did not affect the formation of neuronal dendrites in the PVD sensory neuron | ||
Remark | (Data not shown) B0511.6 RNAi | ||||
Method | RNAi |