WormBase Tree Display for RNAi: WBRNAi00097923
expand all nodes | collapse all nodes | view schema
| WBRNAi00097923 | Homol | Homol_homol | F52B5:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gttcgaattgttgcctatccacgacgtgactggaagaatttctgtgagcgagaagacgcaaaacaaaaggatttcagatttcccgagttacctgcctacaagaaggcgagcctagaatcgataaatatcaaacaagaggtcaatctagagaacatgttcaacgtgaccaatactactgcacaggtttgtctagaatatgatttaaaagaatttggaaaatagtaaataacttcaatttccaaaatcatgccttgtagaaatatcaattttctgccagaagaatataccatatttatcatgattcttttcaattttctatagaaaaacgttttcttcttgtttccgtcgaatgaacaaaaactgaattgaaattcgatatcttatctcccaatgacttcctttatgcgtaatgtttgctcgaccacaaagctttgaaatgttttatttcgatctaattttttaaatatatatgctctaattcccaagacattcaattattttctcaacgcaatatgaaataagattttaaatttacagatggaaccatcaacttcatattcatctccatcaaacagtaataatcggaagagatttttgaatgagtgtgattctccaaataatgattatacaatgatgcacagaactccaccagtaacaggttatgcaagtcgtcttcatggatgcgttcctccgattgaaactgaacacgaaaactgtcaatctccgtcgatgaagagaagtcgctgtaccaattattcgtttagaacgctcactgtaagtatttttagctcactcttaaagcaatattataattaattttgattcacaataaatttcagctgtcgactgctgagtatacaaaagtcgtcgaatttctggcacgcgaagcaaaagttcccagatacacttgggttccgacgcaagtagtctcccatatattgccaactgaaggacttgaaaggtatttataaagatttataaagattgccgtaatttcttttttttgaagattcctcaccgctataaaagcagggcacgattcagtgttgttcaatgcaaacggaatttatacaatgggggatatgattagagaattcgagaaacataatgacatcttcgaaagaattggtatcgattcttcgaaattgtcgaaatactacgaagcgtttctcagcttttaccgcatccaggaagcgatga | |||
| Experiment | Laboratory | TG | |||
| Date | 27 Sep 2001 00:00:00 | ||||
| Treatment | Approximately three P0 worms were added to the RNAi plate and incubated at 15 degrees Celsius for 72 hours. Three single F1 worms were each transferred into a new, freshly seeded plate and were allowed to lay eggs for approximately 20 hr. F1 worms were aspirated, and F2 worms were allowed to grow up to the L4 stage, irradiated with an X-ray source, and mitotic germlines analyzed for radiation-induced cell cycle arrest. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F52B5.5a | Inferred_automatically | RNAi_primary | |
| F52B5.5b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00000467 | Inferred_automatically | RNAi_primary | ||
| Transcript | F52B5.5b.1 | Inferred_automatically | RNAi_primary | ||
| F52B5.5b.4 | Inferred_automatically | RNAi_primary | |||
| F52B5.5b.2 | Inferred_automatically | RNAi_primary | |||
| F52B5.5a.1 | Inferred_automatically | RNAi_primary | |||
| F52B5.5b.3 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004952 | ||||
| Phenotype_not_observed | WBPhenotype:0002179 | Remark | cep-1 RNAi did not affect mitotic germ cell arrest in response to X-ray radiation | ||
| Remark | (Figure S1a) cep-1 RNAi | ||||
| Method | RNAi |
